Primer3 để thiết kế mồi cho phản ứng PCR

Thứ bảy - 12/03/2016 23:36
Primer3 là chương trình được sử dụng phổ biến để thiết kế mồi (primer) cho phản ứng PCR (Polymerase Chain Reaction). Đây là chương trình mã nguồn mở, do Steve Rozen and Helen Skaletsky phát triển tại Whitehead Institute và Howard Hughes Medical Institute, USA. (http://frodo.wi.mit.edu/primer3/)
Software 1
Software 1
Primer3 cũng có thể dùng để thiết kế các mẫu dò (probe) và các primer cho giải trình tự.
Vì PCR được sử dụng cho nhiều mục đích khác nhau nên Primer3 có nhiều các thông số mà bạn có thể điều chỉnh để tạo ra những primer tốt nhất cho mục đích của bạn.
Đây là giao diện của chương trình Primer3:
 (http://frodo.wi.mit.edu/primer3/input.htm)



Ở đây tôi chỉ hướng dẫn các bạn sử dụng chương trình này một cách đơn giản nhất thông qua ví dụ sau:
VD: Một loài thực vật hoặc vi sinh vật nào đó đã được chuyển gene biểu hiện protein huỳnh quang eGFP (enhanced green fluorescent protein).       Bây giờ sinh vật này đã có thể phát sáng, nhiệm vụ của bạn là thiết kế primer đặc hiệu cho gene eGFP để kiểm tra xem gene này đã được gắn vào genome của sinh vật hay chưa.


Nấm được chuyển gene eGFP

Để thiết kế mồi, bạn cho trình tự của gene eGFP (720 bp) vào khung chính của Primer3:

 
ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAA
ACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTT
CATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAG
TGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACG
TCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGG
CGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCAC
AAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGG
TGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACAC
CCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAA
GACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCA

 
TGGACGAGCTGTACAAGTAA




Bạn hãy nhấp chuột vào Pick Primers để tìm ra cặp primer tốt nhất (mồi bên trái và mồi bên phải) mà chương trình đề nghị.
Kết quả là bạn sẽ nhận được 1 cặp mồi chính (ở đầu cửa sổ) 


và 4 cặp mồi bổ sung (ở cuối cửa sổ)


Tuy nhiên các cặp mồi chính và phụ chỉ cho sản phẩm PCR với kích thước <220 bp và chỉ phù hợp cho Real-Time PCR. Đối với PCR thông thường, sản phẩm nên >250 bp để dễ dàng quan sát được trên bản Gel sau khi điện di.

Để nhận được cặp mồi hoàn hảo cho sản phẩm > 250 bp (thường là 500-1000 bp), bạn có thể sử dụng mẹo như sau:
Bạn kết hợp mồi trái của cặp mồi chính với mồi phải của một trong các cặp mồi phụ (2 hoặc 3 hoặc 4): copy mồi trái của cặp chính và mồi phải của cặp phụ, dán vào khung dành cho mồi trái và mồi phải, kiểm tra với Pick Primers.

Mồi trái (chính) + Mồi phải (phụ 2)



 Kết quả: 2 mồi này không thể kết hợp với nhau (No Acceptable Primers Were Found)


Mồi trái (chính) + Mồi phải (phụ 3)
Kết quả: 2 mồi này kết hợp tốt với nhau (sản phẩm PCR là 552 bp)


Mồi trái (chính) + Mồi phải (phụ 4)
Kết quả: 2 mồi này cũng kết hợp tốt với nhau (sản phẩm PCR là 551 bp)

Như vậy bạn có thể sử dụng 1 trong 2 cặp mồi sau để thực hiện phản ứng PCR đặc hiệu cho gene eGFP:

Cặp 1:
Mồi xuôi (Forward primer): 
eGFP-FW: ACGTAAACGGCCACAAGTTC
Mồi ngược (Reverse primer): 
eGFP-RV: ACTGGGTGCTCAGGTAGTGG

Cặp 2:
Mồi xuôi (Forward primer): 
eGFP-FW: ACGTAAACGGCCACAAGTTC
Mồi ngược (Reverse primer): 
eGFP-RV: CTGGGTGCTCAGGTAGTGGT


Hướng dẫn tải file:

- Bấm vào link bên dưới, đợi 5s. Click vào nút: Bỏ qua quảng cáo. Chi tiết xem thêm tại đây: https://www.sinhhoc.edu.vn/biology/index.php/about/Huong-dan-su-dung-Website.html
 
Mật khẩu file:  sinhhoc.edu.vn
 
Hướng dẫn mở file:
- Cách đổi đuôi file: https://www.sinhhoc.edu.vn/biology/index.php/about/Huong-dan-cach-thay-doi-duoi-file-trong-Windows-XP-7-8.html
- Tải file về, bấm chuột phải vào file, chọn Rename. Giữ nguyên tên file, đổi 2 kí tự HT thành ar rồi dùng Winrar (phiên bản Winrar 5.0 trở lên) giải nén với mật khẩu ở trên. Nếu có thắc mắc liên hệ: 0975.421.186.

 
Trân trọng!

Tác giả bài viết: Nguyễn Huy Hoàng

Chú ý: Việc đăng lại bài viết trên ở website hoặc các phương tiện truyền thông khác mà không ghi rõ nguồn https://wWw.YSinhHoc.vn là vi phạm bản quyền

Tổng số điểm của bài viết là: 5 trong 1 đánh giá

Xếp hạng: 5 - 1 phiếu bầu
Click để đánh giá bài viết

  Ý kiến bạn đọc

Những tin mới hơn

Thảo luận
Fan page
Thống kê truy cập
  • Đang truy cập90
  • Hôm nay10,050
  • Tháng hiện tại117,374
  • Tổng lượt truy cập7,439,172

Hướng dẫn kiếm tiền bằng rút gọn link với Ouo.io

Ouo.io&nbsp;là một cái tên còn khá mới mẻ trong lĩnh vực rút gọn links kiếm tiền hiện nay. Sở dĩ tôi nói như vậy là bởi vì nó mới chỉ xuất hiện trong khoảng đầu năm 2015 này. Điều gì đã khiến&nbsp;Ouo.io&nbsp;trở nên nổi tiếng và được chú ý nhiều đến vậy? Câu trả lời không thể nào khác, đó...

Thăm dò ý kiến

Bạn muốn Website cung cấp thêm ebook về lĩnh vực?

Tiện ích
 Trình duyệt Web

 Firefox


 Trình duyệt Web

 Google Chorme


 Bộ gõ Unikey

 Unikey 4.2 RC4


 Bộ gõ Vietkey

 Vietkey 2007


 Bộ gõ tiếng Việt

 Gõ tiếng Việt


 Tăng tốc tải file

 IDM 6.25


 TeamviewerHỗ trợ từ xa

 Team Viewer v11


 Đọc PDF

 PDF Reader v7.3.0.0118


 Cắt và nối file *.001 ..

 FFSJ


 Nén & Giải nén

 WinRAR 5.31

Monkey Junior
Bạn đã không sử dụng Site, Bấm vào đây để duy trì trạng thái đăng nhập. Thời gian chờ: 60 giây